GPHN (2 of 2)

Ensembl ID:
ENSDARG00000089076
Description:
gephyrin [Source:HGNC Symbol;Acc:15465]
Human Orthologue:
GPHN
Human Description:
gephyrin [Source:HGNC Symbol;Acc:15465]
Mouse Orthologue:
Gphn
Mouse Description:
gephyrin Gene [Source:MGI Symbol;Acc:MGI:109602]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36467 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42972 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127692 Essential Splice Site 299 844 9 34
Genomic Location (Zv9):
Chromosome 17 (position 34315331)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 34157062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCACATCAACACCCACGTTCAACATCAACCAGTTATAGATATTCAATG[T/A]GATTTTTGTTGACTTGCAGCATTACTTTTACAACATGTTCAAAATCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127692 Essential Splice Site 654 844 29 34
Genomic Location (Zv9):
Chromosome 17 (position 34334506)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 34219430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGTACCAAGTAGAAAATGGAAGTAATTTAGCATGACGGTGTTTTTTA[A/T]TTCTCCCCCTGCAGCCCAGACGACCTGCTGAATGCCCTGAACGAGGGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link