akap8l

Ensembl ID:
ENSDARG00000089073
ZFIN ID:
ZDB-GENE-040426-2303
Description:
A-kinase anchor protein 8-like [Source:RefSeq peptide;Acc:NP_998384]
Human Orthologues:
AKAP8, AKAP8L
Human Descriptions:
A kinase (PRKA) anchor protein 8 [Source:HGNC Symbol;Acc:378]
A kinase (PRKA) anchor protein 8-like [Source:HGNC Symbol;Acc:29857]
Mouse Orthologues:
Akap8, Akap8l
Mouse Descriptions:
A kinase (PRKA) anchor protein 8 Gene [Source:MGI Symbol;Acc:MGI:1928488]
A kinase (PRKA) anchor protein 8-like Gene [Source:MGI Symbol;Acc:MGI:1860606]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19640 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24861 Nonsense Mutation detected in F1 DNA During 2014
sa19641 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126152 Essential Splice Site 7 508 1 11
Genomic Location:
Chromosome 1 (position 60320276)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCACACACACAGATCACTGCAGCACGATGGATAGAGGATATTCTTCAG[G/A]TTTGTCTTTTATTCTTTTTTACCTGTTTTTCAGTCGTATATACGTGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24861
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126152 Nonsense 28 508 3 11
Genomic Location:
Chromosome 1 (position 60322117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTGCTGGCTCATCTGTGCTGTGTGCTGTGCTCAGGCTCAGGTGGTTA[T/G]GATATGTACGGCTATAAAGACTCAATGTCAGGCGGTGGTGGGTACGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126152 Nonsense 126 508 4 11
Genomic Location:
Chromosome 1 (position 60324873)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGCCTCCATGGGCCCTCGAGATCTCTACAGATCTGCTGGCTACGGTTA[C/A]AGCGACTCCCGGGGCGACATGATGGCCCAGCGCGGAGGCTTTGGGCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n2vbsnfa