NHSL2 (1 of 2)

Ensembl ID:
ENSDARG00000089066
Description:
NHS-like 2 [Source:HGNC Symbol;Acc:33737]
Human Orthologue:
NHSL2
Human Description:
NHS-like 2 [Source:HGNC Symbol;Acc:33737]
Mouse Orthologue:
Nhsl2
Mouse Description:
NHS-like 2 Gene [Source:MGI Symbol;Acc:MGI:3645090]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14872 Nonsense Available for shipment Available now
sa34184 Nonsense Mutation detected in F1 DNA During 2017
sa31596 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082464 Nonsense 1016 1221 6 8
Genomic Location (Zv9):
Chromosome 7 (position 52929117)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51198867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTGAGGGAGATTTGCTTAAAGATGAAGAGGAAGACTATTCTGCCAAG[C/T]AAATTTCACATGAAAACCACCAAATTCCTGAACTTTATGAGACCTTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082464 Nonsense 1118 1221 8 8
Genomic Location (Zv9):
Chromosome 7 (position 52928200)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51197950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGCTGTTATTCTAACATTTCTATTGTTCTGCCTTTCCTAGGTCAAAG[A/T]GAAAAGTTCTTGGTCGAAAGGAACCATCAGATTCTTTTGGAAGAAGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082464 Nonsense 1161 1221 8 8
Genomic Location (Zv9):
Chromosome 7 (position 52928071)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51197821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACAGACTTCAGAACTCTGGGCCTTGGGACTACACCTCGGTCAAGCTCA[C/T]GAAATGAAAACTTTATGGCTCTCCTCCAAAAGAGGAGCAGCAAAGCTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link