LOC100149369

Ensembl ID:
ENSDARG00000089057
Human Orthologue:
LRRC56
Human Description:
leucine rich repeat containing 56 [Source:HGNC Symbol;Acc:25430]
Mouse Orthologue:
Lrrc56
Mouse Description:
leucine rich repeat containing 56 Gene [Source:MGI Symbol;Acc:MGI:1917802]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7532 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130773 Missense 210 221 7 7
Genomic Location:
Chromosome 25 (position 26308899)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGATGATGTACCTGTTGAATTAGAAAAATCTCAGTGCAATGGCTCTTCAC[T/C]GCTGGACTGGACTCTTCTCAAAGAATCAATCAAAGACAGTTCAGTTATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nvrua3p9