LOC100333801

Ensembl ID:
ENSDARG00000089046
Human Orthologue:
MTMR3
Human Description:
myotubularin related protein 3 [Source:HGNC Symbol;Acc:7451]
Mouse Orthologue:
Mtmr3
Mouse Description:
myotubularin related protein 3 Gene [Source:MGI Symbol;Acc:MGI:1921552]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13441 Essential Splice Site Available for shipment Available now
sa6957 Nonsense Mutation detected in F1 DNA During 2016
sa13990 Nonsense Available for shipment Available now
sa31410 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125655 Essential Splice Site 278 781 8 15
Genomic Location (Zv9):
Chromosome 5 (position 763726)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150702.1 200038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGGCTCCTGTGTTCACAATCAYGCTAACGGCACCATCAGTGGCTCCGG[T/C]ACGTAAAAGTGGGTGCGTCTCAATCAGCMCCCTTGTTTACTATGAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125655 Nonsense 497 781 13 15
Genomic Location (Zv9):
Chromosome 5 (position 768550)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150702.1 204862
KASP Assay ID:
554-4498.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGTGTTTTRTTGCTGCAGGTGAAGCTGGTGCAGCACACATACTCCTG[T/A]CTGTTCGGGACGTTCCTGTGTAACAGTGTGAAGGAGCGAGAGGAGCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125655 Nonsense 513 781 13 15
Genomic Location (Zv9):
Chromosome 5 (position 768596)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150702.1 204908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGWCTGTTCGGGACGTTCCTGTGTAAYAGTGTGAAGGAGCGAGAGGAG[C/T]AGCGCGTACAGGAGAAAACCTGCTCTGTTTGGTCTCTGCTGCGGCCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125655 Nonsense 531 781 13 15
Genomic Location (Zv9):
Chromosome 5 (position 768650)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150702.1 204962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTACAGGAGAAAACCTGCTCTGTTTGGTCTCTGCTGCGGCCTGCCAAT[C/T]AGTCCTTCCACAACATCCTCTACTCTCCACGCTCAGAGACGGTACCATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link