LOC796404

Ensembl ID:
ENSDARG00000089038
Human Orthologue:
PLEKHG5
Human Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 5 [Source:HGNC Symbol;Ac
Mouse Orthologue:
Plekhg5
Mouse Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 5 Gene [Source:MGI Symbo

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6750 Nonsense Mutation detected in F1 DNA During 2014
sa14396 Nonsense Available for shipment Available now
sa8023 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24392 Nonsense Mutation detected in F1 DNA During 2014
sa5064 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127492 Nonsense 229 1110 7 22
Genomic Location:
Chromosome 23 (position 37761127)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACTCCATTGTCTCTYGACTTCGAGGCRTTCCGTTTYGGTGGACGTTA[T/A]CTCAAAGTGAAAGGTGAGAATGTTATTACAGATTGTGRCATGGTTTGAAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127492 Nonsense 266 1110 8 22
Genomic Location:
Chromosome 23 (position 37761672)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTCGCTCAGCCTGCCCAACATCAAGCYGTCAGTAGGGGGCAGCGTCTA[C/A]ATCCTCACGCCRGCCACTGACAAACCAGAGCACAGTTCCCTGCCYCGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127492 Essential Splice Site 289 1110 8 22
Genomic Location:
Chromosome 23 (position 37761742)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAACCAGAGCACAGTTCCCTGCCCCGCAGAGACAGYGTCGACATACTG[G/A]TCAGTCATGCTGCTTTGTCTGTCTACACACACTCAAGCCTTTTACATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127492 Nonsense 627 1110 15 22
Genomic Location:
Chromosome 23 (position 37797731)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGATGCGCCAGCGGCAGGAGCAGCAGAAACTGGCAGCCACTTCAGCT[C/T]GAGTCGAGTCATACGAGGCCGTGGAGGGAGCCAGTGAGGAGGTGGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127492 Essential Splice Site 965 1110 20 22
Genomic Location:
Chromosome 23 (position 37807506)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTCAAGCGCCAGTTCAGCGCCGTCTGCCATTTTTGGAGAGACTCGTAG[G/A]TAAATAAAACTGCATTTACTGTAATGTAATACTNNNTTGACGTAAATGATTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • QT interval: Common variants at ten loci influence QT interval duration in the QTGEN Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kk4s8vy8