C10orf90

Ensembl ID:
ENSDARG00000089024
Description:
chromosome 10 open reading frame 90 [Source:HGNC Symbol;Acc:26563]
Human Orthologue:
C10orf90
Human Description:
chromosome 10 open reading frame 90 [Source:HGNC Symbol;Acc:26563]
Mouse Orthologue:
D7Ertd443e
Mouse Description:
DNA segment, Chr 7, ERATO Doi 443, expressed Gene [Source:MGI Symbol;Acc:MGI:1196431]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10450 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126327 Nonsense 180 714 1 11
Genomic Location:
Chromosome 12 (position 45515100)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGCCCAKACAAAGACATGTGATTCTGACRGACGTMCCCAACAAYCGA[C/T]ARGACAACAGCAGGGGTCAGCAGGTGAGAAAGTGCAAAAGAGACTAATTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tgrbf853