NP_001185793.1

Ensembl ID:
ENSDARG00000089019
Description:
hypothetical protein LOC568697 [Source:RefSeq peptide;Acc:NP_001185793]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22463 Nonsense Available for shipment Available now
sa9427 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129743 Nonsense 15 241 1 5
Genomic Location (Zv9):
Chromosome 14 (position 22239183)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20940671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAATAATGTCGCTACGAGGAGTTCTGAAGTTTATTCAACGCTCTAATT[T/A]GGGGTTGCTGGTAAGGTCTTTAAAACTAACTAACTTAGCATTCAGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129743 Essential Splice Site 106 241 4 5
Genomic Location (Zv9):
Chromosome 14 (position 22234805)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20936293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTTATTCCATGAACTTAGCATGTGATTATTGTTATTGTGCTTYTATAACA[G/A]GTGGTYTGTCAAAAGCAGATCGGGAACTGATTGTTGTTGCGRCCAGCGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link