TMEFF2 (3 of 3)

Ensembl ID:
ENSDARG00000089012
Description:
transmembrane protein with EGF-like and two follistatin-like domains 2 [Source:HGNC Symbol;Acc:11867
Human Orthologue:
TMEFF2
Human Description:
transmembrane protein with EGF-like and two follistatin-like domains 2 [Source:HGNC Symbol;Acc:11867
Mouse Orthologue:
Tmeff2
Mouse Description:
transmembrane protein with EGF-like and two follistatin-like domains 2 Gene [Source:MGI Symbol;Acc:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20636 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20636
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129959 Nonsense 24 145 1 3
Genomic Location:
Chromosome 6 (position 8931413)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGACAGACACGCAGACCGCCGCGGCAGGAGAATCGGACACATGTAGTTT[T/A]AATCACGACCTATTGCTTTTTTTGTATATCACCGCTGAAACAACTTTGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0h75aeg7