si:ch211-207e14.4

Ensembl ID:
ENSDARG00000089004
ZFIN ID:
ZDB-GENE-030131-3405
Human Orthologue:
IL17RD
Human Description:
interleukin 17 receptor D [Source:HGNC Symbol;Acc:17616]
Mouse Orthologue:
Il17rd
Mouse Description:
interleukin 17 receptor D Gene [Source:MGI Symbol;Acc:MGI:2159727]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15323 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15323
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128759 Nonsense 232 588 7 12
ENSDART00000132668 Nonsense 200 461 7 12
Genomic Location (Zv9):
Chromosome 23 (position 34326337)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 34088284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGGCATCCCACATAWGTTGAGGTCCACCAGGAGAAMMGGGATGTTTA[T/A]GTGACCTTTAACCTTGCCYCTGAGAACTTTGGAGTTCATCAGTATTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link