LOC560686

Ensembl ID:
ENSDARG00000088999
Human Orthologue:
METTL4
Human Description:
methyltransferase like 4 [Source:HGNC Symbol;Acc:24726]
Mouse Orthologue:
Mettl4
Mouse Description:
methyltransferase like 4 Gene [Source:MGI Symbol;Acc:MGI:1924031]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16884 Nonsense Available for shipment Available now
sa41089 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128678 Nonsense 331 450 6 8
Genomic Location (Zv9):
Chromosome 7 (position 75267312)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71338300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGATCAGGAGAGTTTGTGTTTCCTCTGGATTCACAACACAAGAAGCCTTA[T/A]GAAGTGCTGGTGCTGGGCAGGTGTCGCTCCACCTCTGACCATACAGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128678 Essential Splice Site 348 450 7 8
Genomic Location (Zv9):
Chromosome 7 (position 75266345)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71337333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCTTCCTCCTCTTCATATTGTGATCTCCACATCTGTGTGTGTTTCA[G/A]ATGTTCAGCAGTGAATGAGCTTCCAGATCAGCGTCTGCTCGTCAGCGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link