si:ch73-287m6.1

Ensembl ID:
ENSDARG00000088977
ZFIN ID:
ZDB-GENE-100920-2
Human Orthologue:
RIMBP2
Human Description:
RIMS binding protein 2 [Source:HGNC Symbol;Acc:30339]
Mouse Orthologue:
Rimbp2
Mouse Description:
RIMS binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2443235]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37270 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129358 Essential Splice Site 34 1052 1 22
ENSDART00000137739 Essential Splice Site 34 1138 6 25

The following transcripts of ENSDARG00000088977 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 16808784)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18317172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGGCTTTCCTCAACTCCAGACAGCAGGAGATCAACCTTCTGCAGAAG[G/A]TAAAAACAGCTGCACACACACACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link