si:ch211-14k19.7

Ensembl ID:
ENSDARG00000088975
ZFIN ID:
ZDB-GENE-090313-42

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9681 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125596 Nonsense 985 1203 7 11
ENSDART00000147833   None 181 None 5
Genomic Location (Zv9):
Chromosome 1 (position 8181019)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8420824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTGAATACTGTAAACATCAGGGCATCTGYGTTCACCGCCTCGGGCAG[C/T]AGCCTATCTGCCAGTAAGTTATATAGCATAACAGATTTTTGACTTGYGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link