si:dkey-211h10.5

Ensembl ID:
ENSDARG00000088950
ZFIN ID:
ZDB-GENE-090313-237
Human Orthologue:
SYCP2
Human Description:
synaptonemal complex protein 2 [Source:HGNC Symbol;Acc:11490]
Mouse Orthologue:
Sycp2
Mouse Description:
synaptonemal complex protein 2 Gene [Source:MGI Symbol;Acc:MGI:1933281]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37635 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128746 Essential Splice Site 242 330 7 11
ENSDART00000144104 Essential Splice Site 907 995 22 26

The following transcripts of ENSDARG00000088950 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12324796)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12283598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGAGCAGGATGATGTTGTTTTGAGAGGCATGGAGGAGGAATTGATGG[T/C]AAGGAGGGTGCTGACTTGTCAAATGGCCAGTAATAAGAATAATTATACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link