LOC100001834

Ensembl ID:
ENSDARG00000088933
Human Orthologue:
GOLT1A
Human Description:
golgi transport 1A [Source:HGNC Symbol;Acc:24766]
Mouse Orthologue:
Golt1a
Mouse Description:
golgi transport 1 homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915588]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41824 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125024 Nonsense 82 133 3 5
Genomic Location (Zv9):
Chromosome 11 (position 24262685)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23075282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGCTCCGCCTTCTTTCTGGGAGGCGTGGCTTTAGTACTGCTAAGAT[G/A]GCCTCGTATTGGCATGTTAGTGGAGACATATGGCTTTGTGCTTCTATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link