DPP10 (1 of 2)

Ensembl ID:
ENSDARG00000088928
Description:
dipeptidyl-peptidase 10 (non-functional) [Source:HGNC Symbol;Acc:20823]
Human Orthologue:
DPP10
Human Description:
dipeptidyl-peptidase 10 (non-functional) [Source:HGNC Symbol;Acc:20823]
Mouse Orthologue:
Dpp10
Mouse Description:
dipeptidylpeptidase 10 Gene [Source:MGI Symbol;Acc:MGI:2442409]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25442 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21621 Nonsense Available for shipment Available now
sa34798 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127700 Essential Splice Site 146 173 5 6
Genomic Location (Zv9):
Chromosome 9 (position 58076309)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149757.1 12688
KASP Assay ID:
554-7570.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTTTCTCCAGACCTCACACACATGCTGCTGGCATATGATGTCAGAAAG[G/A]TCAAACAAGCTTCATTAAAAAAAAAAGTAAATGTAATACTATATCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127700 Nonsense 159 173 6 6
Genomic Location (Zv9):
Chromosome 9 (position 58076435)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149757.1 12814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTGTTTTAGGTGTATCGATTCTCCTTCCTGGCATCTTATTTGATCTA[C/A]AACTTGCAGACAAGGTACAGTGTGTTTCAGATCAGACACGCCATGCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34798
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127700 Nonsense 171 173 6 6
Genomic Location (Zv9):
Chromosome 9 (position 58076469)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149757.1 12848
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTTATTTGATCTACAACTTGCAGACAAGGTACAGTGTGTTTCAGATC[A/T]GACACGCCATGCACATCAGAAAGTGATGATAATGTGTGTGTGTGTGTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link