ATP9A

Ensembl ID:
ENSDARG00000088925
Description:
ATPase, class II, type 9A [Source:HGNC Symbol;Acc:13540]
Human Orthologue:
ATP9A
Human Description:
ATPase, class II, type 9A [Source:HGNC Symbol;Acc:13540]
Mouse Orthologue:
Atp9a
Mouse Description:
ATPase, class II, type 9A Gene [Source:MGI Symbol;Acc:MGI:1330826]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18345 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124730 Essential Splice Site 432 1042 14 31
Genomic Location:
Chromosome 23 (position 39106912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTWTATTYAAAGACCTGGAACAGCACAGTCACTCATGTTTGATTCTCACA[G/A]CCTCCTCAGGACCTGCAGGCGTCTCGAGCWCCAGGCGCCACTAAAGTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r394o77d