LOC100151245

Ensembl ID:
ENSDARG00000088912
Human Orthologues:
RGS17, RGS19, RGS20
Human Descriptions:
regulator of G-protein signaling 17 [Source:HGNC Symbol;Acc:14088]
regulator of G-protein signaling 19 [Source:HGNC Symbol;Acc:13735]
regulator of G-protein signaling 20 [Source:HGNC Symbol;Acc:14600]
Mouse Orthologues:
Rgs17, Rgs19, Rgs20
Mouse Descriptions:
regulator of G-protein signaling 17 Gene [Source:MGI Symbol;Acc:MGI:1927469]
regulator of G-protein signaling 19 Gene [Source:MGI Symbol;Acc:MGI:1915153]
regulator of G-protein signaling 20 Gene [Source:MGI Symbol;Acc:MGI:1929866]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6711 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129260 Essential Splice Site 63 193 2 5
Genomic Location:
Chromosome 22 (position 23511187)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACATCAGATGTGTTTTGACTCAGAAAAAGACTGAAGTCTCTCATTCTCC[G/T]TAAGTTTATGTGTGCTGTTATGTGTATAGTTTATRTTTATGTGTATRCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kj8fxiu9