si:dkey-1b17.11

Ensembl ID:
ENSDARG00000088903
ZFIN ID:
ZDB-GENE-050208-786
Description:
Si:dkey-1b17.11 protein [Source:UniProtKB/TrEMBL;Acc:A8KBJ0]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13519 Nonsense Available for shipment Available now
sa3184 Nonsense F2 line generated During 2017
sa37410 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106493 Nonsense 26 267 3 3
ENSDART00000132151 Nonsense 62 303 3 3
Genomic Location (Zv9):
Chromosome 22 (position 2926982)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1739830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAATGTTACTCATTTACTTCATTTTCAGATGTGATGGTGAAGGAGGAA[G/T]RACTGAGWGAAGAWGAGGAGAAACATCATGTCAAGAGTGAAGATGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3184
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106493 Nonsense 112 267 3 3
ENSDART00000132151 Nonsense 148 303 3 3
Genomic Location (Zv9):
Chromosome 22 (position 2927240)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1740088
KASP Assay ID:
554-3148.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCTTCAATCGTTTAGGAACCCTAAAAACACACATGCTGCTCCACACC[G/T]GAGAGAAAACACACACATGTGAGCAATGCGGCAAGTCATTTTTGAGGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106493 Nonsense 189 267 3 3
ENSDART00000132151 Nonsense 225 303 3 3
Genomic Location (Zv9):
Chromosome 22 (position 2927471)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1740319
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTGCTGTGAGTGCGAGAAGACTTTTATTACAGCGGTAGACTTGAGA[C/T]GACACCAGAGGAGTCACACTGAGGAGAAACCGTACAAGTGTTTACACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link