si:dkey-21o19.2

Ensembl ID:
ENSDARG00000088900
ZFIN ID:
ZDB-GENE-090313-241
Human Orthologue:
PLEKHG3
Human Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 3 [Source:HGNC Symbol;Ac
Mouse Orthologue:
Plekhg3
Mouse Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 3 Gene [Source:MGI Symbo

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25197 Nonsense Mutation detected in F1 DNA During 2017
sa24324 Nonsense Available for shipment Available now
sa14419 Nonsense Available for shipment Available now
sa37696 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37697 Essential Splice Site Available for shipment Available now
sa15459 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128986 Nonsense 134 387 5 12
ENSDART00000144478   None 159 None 5
Genomic Location (Zv9):
Chromosome 23 (position 24408734)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24195300
KASP Assay ID:
554-7589.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATGTCTATGTATTATGATTTCTGTCTGCAGGCTATGAGCGAAAGATA[T/A]CTGGTTTTATTTTCCTTCCACTTGTTAATCCTTGCTTTGGACGGTTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128986 Nonsense 173 387 6 12
ENSDART00000144478   None 159 None 5
Genomic Location (Zv9):
Chromosome 23 (position 24410069)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24196635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGGGTATTCTTCCTCTCTCAGCCATTGAAGTGCATCTGATCCCACAG[C/T]AGGACTCCAGTTCGCCACATATGTTTGAGATTAGTGGTAAGAGCCTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14419
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128986 Nonsense 254 387 8 12
ENSDART00000144478 Nonsense 26 159 1 5
Genomic Location (Zv9):
Chromosome 23 (position 24411642)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24198208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAGGAGGAGCTGAAAAGATACTTGCTGCGGTCTCCCATCATGCAATG[G/A]GAAGGAGTCCCCATTCAGCACATGGGACATCCAAGATACCTCTCACTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128986 Essential Splice Site 339 387 10 12
ENSDART00000144478 Essential Splice Site 111 159 3 5
Genomic Location (Zv9):
Chromosome 23 (position 24413812)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24200378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATGGAAAGATCAGCACTGCCTGGCAGACTGGAGTTTGAACTAACAGG[T/G]ATGTATCAAGCTGTGAAACTAGTTACACGCACAAACTAAATGAATCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128986 Essential Splice Site 339 387 11 12
ENSDART00000144478 Essential Splice Site 111 159 4 5
Genomic Location (Zv9):
Chromosome 23 (position 24416399)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24202965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCATGTTTTATGCTGATTTATGCCGACGATGAGTGATGTATTTTCC[A/T]GGTGAACTGATGGAGCCTCTGCTTGTCTCCTGTATTTACCCTGAGGACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128986 Nonsense 363 387 11 12
ENSDART00000144478 Nonsense 135 159 4 5
Genomic Location (Zv9):
Chromosome 23 (position 24416472)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24203038
KASP Assay ID:
2261-7719.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCTCCTGTATTTACCCTGAGGACTATCAAAGCYGGWTCTTCCAGTTA[C/T]AACAGGCAAGACTGCAGTKTTTGGATTTCCTCGACACCRCTTTCAACTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link