ralgapb

Ensembl ID:
ENSDARG00000088899
Human Orthologue:
RALGAPB
Human Description:
Ral GTPase activating protein, beta subunit (non-catalytic) [Source:HGNC Symbol;Acc:29221]
Mouse Orthologue:
Ralgapb
Mouse Description:
Ral GTPase activating protein, beta subunit (non-catalytic) Gene [Source:MGI Symbol;Acc:MGI:2444531]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11896 Nonsense Available for shipment Available now
sa16921 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130978 Nonsense 143 1490 3 29
Genomic Location:
Chromosome 6 (position 58213840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACCAGAGAACTTCAGCCTGGTGCACTTTAAACTGTGTCAGCAAGTGT[T/A]GTCGGCGGTGCAGAAACTAGCGCGAGACTCATCCAGCATGGCCAGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130978 Nonsense 812 1490 16 29
Genomic Location:
Chromosome 6 (position 58279227)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGTGGAGTCGTCTGACCGYAAGCGTGCCGTCAGCTCRGTCTGCAGTTA[T/A]ATTGTGTATCAATGCAGTCGTCCAGCTCCGCTTCATTCCAGAGATCTGMA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3txfwre5