ralgapb

Ensembl ID:
ENSDARG00000088899
Human Orthologue:
RALGAPB
Human Description:
Ral GTPase activating protein, beta subunit (non-catalytic) [Source:HGNC Symbol;Acc:29221]
Mouse Orthologue:
Ralgapb
Mouse Description:
Ral GTPase activating protein, beta subunit (non-catalytic) Gene [Source:MGI Symbol;Acc:MGI:2444531]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11896 Nonsense Available for shipment Available now
sa33987 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31547 Essential Splice Site Available for shipment Available now
sa16921 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130978 Nonsense 143 1490 3 29
Genomic Location (Zv9):
Chromosome 6 (position 58213840)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58310893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACCAGAGAACTTCAGCCTGGTGCACTTTAAACTGTGTCAGCAAGTGT[T/A]GTCGGCGGTGCAGAAACTAGCGCGAGACTCATCCAGCATGGCCAGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130978 Essential Splice Site 468 1490 8 29
Genomic Location (Zv9):
Chromosome 6 (position 58246896)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58343949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCCACTGTAAACTGCACTCCGGCCTGAGCAGAGACAGCAGCATGACTG[G/A]TAAGAGCATAGCACACGCTTTAATCAACGCTGTGATCACTCCTTTTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130978 Essential Splice Site 469 1490 9 29
Genomic Location (Zv9):
Chromosome 6 (position 58257804)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58354857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC[A/C]GCACTGGCCACTCAAGCTGGAGTTGAACTGAGGCGTAAGGGCTCTCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130978 Nonsense 812 1490 16 29
Genomic Location (Zv9):
Chromosome 6 (position 58279227)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58376280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGTGGAGTCGTCTGACCGYAAGCGTGCCGTCAGCTCRGTCTGCAGTTA[T/A]ATTGTGTATCAATGCAGTCGTCCAGCTCCGCTTCATTCCAGAGATCTGMA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link