LOC562420

Ensembl ID:
ENSDARG00000088898
Human Orthologue:
CALN1
Human Description:
calneuron 1 [Source:HGNC Symbol;Acc:13248]
Mouse Orthologue:
Caln1
Mouse Description:
calneuron 1 Gene [Source:MGI Symbol;Acc:MGI:2155987]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8786 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126185 Essential Splice Site 41 262 1 6
Genomic Location:
Chromosome 15 (position 15720786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAAAGAGCCTGTTGTGCTTGAGTATGCTGYAGACTTTGATTCATATGG[G/A]TAAGCAACAGGGATGACAGCTGCCGTCCYGGGATCTTACCGCTCTGAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/939ha16w