LOC100330721

Ensembl ID:
ENSDARG00000088884
Human Orthologue:
AXL
Human Description:
AXL receptor tyrosine kinase [Source:HGNC Symbol;Acc:905]
Mouse Orthologue:
Axl
Mouse Description:
AXL receptor tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:1347244]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24969 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093248 Essential Splice Site 95 237 2 4
Genomic Location:
Chromosome 15 (position 26391)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGGCAGGGCAACCGTCTCAAACAGCCTCCAGACTGCCTGGACAGCATG[T/C]GAGTTACACCACACTGACACCGGGGTTCACCACAGGGAACAGAGATGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lsnoaw1s