ENSDARG00000088879

Ensembl ID:
ENSDARG00000088879
Human Orthologues:
FOXO1, FOXO3, FOXO4, FOXO6
Human Descriptions:
forkhead box O1 [Source:HGNC Symbol;Acc:3819]
forkhead box O3 [Source:HGNC Symbol;Acc:3821]
forkhead box O4 [Source:HGNC Symbol;Acc:7139]
forkhead box O6 [Source:HGNC Symbol;Acc:24814]
Mouse Orthologues:
Foxo1, Foxo3, Foxo4, Foxo6
Mouse Descriptions:
forkhead box O1 Gene [Source:MGI Symbol;Acc:MGI:1890077]
forkhead box O3 Gene [Source:MGI Symbol;Acc:MGI:1890081]
forkhead box O4 Gene [Source:MGI Symbol;Acc:MGI:1891915]
forkhead box O6 Gene [Source:MGI Symbol;Acc:MGI:2676586]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14769 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124932 Nonsense 120 139 2 2
Genomic Location:
Chromosome 15 (position 3394428)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCTCACCTTGTCTCAGATATACGACTGGATGGTGAAAAGCGTCCCGTA[T/A]TTTAAAGACAAGGGGGATAGTAACAGCWCCGCGGGCTGGAAGGTAYTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g9mnphtv