CLTCL1 (2 of 2)

Ensembl ID:
ENSDARG00000088853
Description:
clathrin, heavy chain-like 1 [Source:HGNC Symbol;Acc:2093]
Human Orthologue:
CLTCL1
Human Description:
clathrin, heavy chain-like 1 [Source:HGNC Symbol;Acc:2093]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34275 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123540 Essential Splice Site 133 197 2 3
Genomic Location (Zv9):
Chromosome 8 (position 2240564)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2010049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCGCCGAAACCGCTCAGTTCCAGAAGATCATCCTCTATTCAAAGAAGG[T/C]ACTAGAAGAAGGAAAATGAATGCACACCTGAGGAGTATCATTCACTACCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link