ENSDARG00000088837

Ensembl ID:
ENSDARG00000088837
Human Orthologue:
FAM19A1
Human Description:
family with sequence similarity 19 (chemokine (C-C motif)-like), member A1 [Source:HGNC Symbol;Acc:2
Mouse Orthologues:
Fam19a1, Fam19a3
Mouse Descriptions:
family with sequence similarity 19, member A1 Gene [Source:MGI Symbol;Acc:MGI:2443695]
family with sequence similarity 19, member A3 Gene [Source:MGI Symbol;Acc:MGI:3046463]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18356 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090117 Nonsense 103 141 3 3
Genomic Location:
Chromosome 11 (position 17993599)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAGCCTCCATTGTGATTGGGAAGTGGTGGTGTGAGATGGAGCCATG[T/A]CTGGAGGGAGAAGAGTGCAAGACGCTACCAGACAACTCCGGCTGGATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pi17fpyt