LOC100333297

Ensembl ID:
ENSDARG00000088835
Human Orthologue:
EFS
Human Description:
embryonal Fyn-associated substrate [Source:HGNC Symbol;Acc:16898]
Mouse Orthologue:
Efs
Mouse Description:
embryonal Fyn-associated substrate Gene [Source:MGI Symbol;Acc:MGI:105311]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34057 Nonsense Mutation detected in F1 DNA During 2016
sa17267 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121837 Nonsense 443 990 2 7
Genomic Location:
Chromosome 7 (position 25221248)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCACCGACAAACATGCTGGAGGAGGAGAGACAGGGAAGTAAAAGTGGA[C/T]AGACGCAAGCCGACGAGATGAAGAACAACAGCGAAATGCTGAGCAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121837 Nonsense 560 990 4 7
Genomic Location:
Chromosome 7 (position 25226525)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGAGGATGAGGATGTGTACAGTGTTCCCAGTCTTCCTGGTTTACCCT[T/A]GGAGGCAAGCGAGCTGTCGGGATTAACTGTAGAAACGGTTGTAAACGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link