LOC100000060

Ensembl ID:
ENSDARG00000088817
Human Orthologue:
WDR59
Human Description:
WD repeat domain 59 [Source:HGNC Symbol;Acc:25706]
Mouse Orthologue:
Wdr59
Mouse Description:
WD repeat domain 59 Gene [Source:MGI Symbol;Acc:MGI:2442115]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19192 Nonsense Mutation detected in F1 DNA During 2014
sa7846 Nonsense Mutation detected in F1 DNA During 2014
sa4735 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122009 Nonsense 393 965 13 26
ENSDART00000122009 Nonsense 393 965 13 26
Genomic Location:
Chromosome 18 (position 4522439)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATGACATACCCCAAACTCTGCAGCAGGAGTTTTCTCTAGTCAACTTA[C/T]AGATTCGCAATGTCAATGTGGAGGTCAGTCCCTGTGATGTCTGAAAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122009 Nonsense 393 965 13 26
ENSDART00000122009 Nonsense 393 965 13 26
Genomic Location:
Chromosome 18 (position 4522439)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATGACATACCCCAAACTCTGCAGCAGGAGTTTTCYCTAGTCAACTTA[C/T]AGATTCGCAAYGTCAATGTGGAGGTCAGTCCCTGTGATGTCTGAAAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122009 Essential Splice Site 685 965 21 26
Genomic Location:
Chromosome 18 (position 4601076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACACACTTCTGTACTGCTAATTTACCACTGTTTCACACTTTATGTTTC[A/G]GGTATGGGCACTCGCCTCAGCGTCCACTAATCTTAACCTGAGTCCTGACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1o2aaz76