LOC100000060

Ensembl ID:
ENSDARG00000088817
Human Orthologue:
WDR59
Human Description:
WD repeat domain 59 [Source:HGNC Symbol;Acc:25706]
Mouse Orthologue:
Wdr59
Mouse Description:
WD repeat domain 59 Gene [Source:MGI Symbol;Acc:MGI:2442115]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43028 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43029 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122009 Essential Splice Site 109 965 4 26
Genomic Location (Zv9):
Chromosome 18 (position 4515256)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5264927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCTGGTAAATCACATACGTCTTTGCAAGGCCACACACGTGTAATAAG[G/A]TAACACATGAATTCAAGCTGAAATTACTATGAATTTGGAGGAGCTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122009 Nonsense 904 965 26 26
Genomic Location (Zv9):
Chromosome 18 (position 4609690)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5295058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGTTTGGCGTTTACTGCTGTCACTGTCGCAGTCAGGCTCGCGGCACA[C/T]AGTGCGCCGTCTGCAAGCGCTTCACCTTCCAGTGCTCCATCTGCCATGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link