LOC100001260

Ensembl ID:
ENSDARG00000088813
Human Orthologue:
PPP1R3A
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 3A [Source:HGNC Symbol;Acc:9291]
Mouse Orthologue:
Ppp1r3a
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 3A Gene [Source:MGI Symbol;Acc:MGI:2153588]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24677 Nonsense Mutation detected in F1 DNA During 2014
sa24676 Nonsense Mutation detected in F1 DNA During 2014
sa24675 Nonsense Mutation detected in F1 DNA During 2014
sa11706 Nonsense Available for shipment Available now
sa11483 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127033 Nonsense 652 1207 4 4
Genomic Location:
Chromosome 25 (position 22460999)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTCCAAAAGTTACATCCAGCCAACTAGATCCTTCTCTAGAAGAATGT[A/T]AAGATGAAACGTTCCAGTATGATTATTGCCACAGTTTATTTCCGCTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127033 Nonsense 723 1207 4 4
Genomic Location:
Chromosome 25 (position 22460786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACACTGAAATGTCACAAAACCAGGAGGACCCAACAAACATCCGCACC[A/T]AAGAAGAAGATACATTAGTTCAAACAGAGAATTCAATTATTAACTCTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127033 Nonsense 810 1207 4 4
Genomic Location:
Chromosome 25 (position 22460523)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAACTGGATAACACAGAGATAATTATGTGCAATACTATGCAGACCTG[T/A]AACATGAACGGTAAGAAGGCAGAGTTTTCTTCAAAGACTACAGAGAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11706
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127033 Nonsense 1014 1207 4 4
Genomic Location:
Chromosome 25 (position 22459913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGTACARWAGCATTAGAGAACAGCTGGGATGCCGGTGATCAAGAAATG[A/T]AAGTATTCTGCGAAAGTAAGACTAYGGMTGATTATAAAAACATGGAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127033 Nonsense 1069 1207 4 4
Genomic Location:
Chromosome 25 (position 22459748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTGATGAAGARATGGAGCTATACCTRAACAGTCTGAGGAATTCACAA[C/T]AGTCAGCATTCAGAGAAGGCACRATGAGCGGAAGCAAAARACCMTCTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yteszle0