Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
prox1b
- Ensembl ID:
- ENSDARG00000088810
- ZFIN ID:
- ZDB-GENE-050107-3
- Description:
- prospero-related homeobox gene 1b [Source:RefSeq peptide;Acc:NP_001165058]
- Human Orthologues:
- PROX1, PROX2
- Human Descriptions:
- prospero homeobox 1 [Source:HGNC Symbol;Acc:9459]
- prospero homeobox 2 [Source:HGNC Symbol;Acc:26715]
- Mouse Orthologues:
- Prox1, Prox2
- Mouse Descriptions:
- prospero homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:1920672]
- prospero-related homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:97772]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa20900 | Essential Splice Site | Available for shipment | Available now |
| sa35 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20900
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000127669 | Essential Splice Site | None | 659 | 1 | 5 |
- Genomic Location (Zv9):
- Chromosome 7 (position 21097794)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 19688230 GRCz11 7 19940198 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACCACAGGAAAGTGACCAAGCGGGGGATGCGTGCTGTCTGACTGTTTTG[T/A]AAGTTTTATTGACATCTTTTTGTTCATTAGGACGACTGCGTATTTGTTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000127669 | Nonsense | 236 | 659 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 7 (position 21096143)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 19686579 GRCz11 7 19938547 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGACAGCGACGATCCACTTGTAGGCAATGGATTTTCTCCTCAACGTTG[T/A]TCGTCTAAGAAAAACAATGAAACCAATGGAAATGGCAATGCTGGAATTTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Fasting insulin-related traits: New genetic loci implicated in fasting glucose homeostasis and their impact on type 2 diabetes risk. (View Study)
- Fasting insulin-related traits (interaction with BMI): A genome-wide approach accounting for body mass index identifies genetic variants influencing fasting glycemic traits and insulin resistance. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
