prox1b

Ensembl ID:
ENSDARG00000088810
ZFIN ID:
ZDB-GENE-050107-3
Description:
prospero-related homeobox gene 1b [Source:RefSeq peptide;Acc:NP_001165058]
Human Orthologues:
PROX1, PROX2
Human Descriptions:
prospero homeobox 1 [Source:HGNC Symbol;Acc:9459]
prospero homeobox 2 [Source:HGNC Symbol;Acc:26715]
Mouse Orthologues:
Prox1, Prox2
Mouse Descriptions:
prospero homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:1920672]
prospero-related homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:97772]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20900 Essential Splice Site Available for shipment Available now
sa35 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127669 Essential Splice Site None 659 1 5
Genomic Location (Zv9):
Chromosome 7 (position 21097794)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19688230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCACAGGAAAGTGACCAAGCGGGGGATGCGTGCTGTCTGACTGTTTTG[T/A]AAGTTTTATTGACATCTTTTTGTTCATTAGGACGACTGCGTATTTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127669 Nonsense 236 659 2 5
Genomic Location (Zv9):
Chromosome 7 (position 21096143)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19686579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGACAGCGACGATCCACTTGTAGGCAATGGATTTTCTCCTCAACGTTG[T/A]TCGTCTAAGAAAAACAATGAAACCAATGGAAATGGCAATGCTGGAATTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link