klhl22

Ensembl ID:
ENSDARG00000088807
ZFIN ID:
ZDB-GENE-081104-154
Description:
Novel protein similar to H.sapiens KLHL22, kelch-like 22 (Drosophila) (KLHL22) [Source:UniProtKB/TrE
Human Orthologue:
KLHL22
Human Description:
kelch-like 22 (Drosophila) [Source:HGNC Symbol;Acc:25888]
Mouse Orthologue:
Klhl22
Mouse Description:
kelch-like 22 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1337995]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34511 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129372 Essential Splice Site 74 625 None 6
ENSDART00000140567 Essential Splice Site 74 625 None 7
Genomic Location (Zv9):
Chromosome 8 (position 53989059)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51724418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCCAGGCTCACCGAATTCTCCTGGCGGCGTCGTGTGACTATTTCAGG[T/C]ATGCATGACAGTCCTTACATGTTAGGAATGCTGAGACTATTATGTTTACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link