nes

Ensembl ID:
ENSDARG00000088805
ZFIN ID:
ZDB-GENE-071119-2
Human Orthologue:
NES
Human Description:
nestin [Source:HGNC Symbol;Acc:7756]
Mouse Orthologue:
Nes
Mouse Description:
nestin Gene [Source:MGI Symbol;Acc:MGI:101784]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22867 Nonsense Available for shipment Available now
sa42745 Nonsense Mutation detected in F1 DNA During 2017
sa42746 Nonsense Mutation detected in F1 DNA During 2017
sa32097 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22867
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122681 Nonsense 449 1265 4 4
Genomic Location (Zv9):
Chromosome 16 (position 31279005)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29116194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGACTCTCGAATCCACTCTTCCCAAAACATCTGCAGAACCAAAACCA[G/T]AGCTTCAACCAGAAGAAATTAAGGTGGAAGACGAAGCAAATGAACCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122681 Nonsense 535 1265 4 4
Genomic Location (Zv9):
Chromosome 16 (position 31279265)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29116454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTGTCTGTCGAAATGGCTCGTATCTCACATGCACCCAAGGTTGCTTG[G/A]GAAGAAATCAAATCTGCAGTAGAGGATGAAAAAGATGATGCTTCTGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122681 Nonsense 866 1265 4 4
Genomic Location (Zv9):
Chromosome 16 (position 31280257)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29117446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATGTGGCATCTGTGATGTTTCAGAAAGTCTCTGGAGACCATGAAAGTT[T/A]GGATGTGGTGGTGCAAGAAAGTGAACGCAAGGGTAATCTGGAGAAGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32097
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122681 Nonsense 1118 1265 4 4
Genomic Location (Zv9):
Chromosome 16 (position 31281012)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29118201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAACATTCAAGCATTTCCCCAGTGAATGAGAATCTGGAAAGCTCAAAC[A/T]AAATACCAAGTGTGGCGGAAAACATCTTTGGACATTTTGAAGAACATCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link