LOC100151562

Ensembl ID:
ENSDARG00000088801
Human Orthologue:
FGD5
Human Description:
FYVE, RhoGEF and PH domain containing 5 [Source:HGNC Symbol;Acc:19117]
Mouse Orthologue:
Fgd5
Mouse Description:
FYVE, RhoGEF and PH domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2443369]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16294 Nonsense Available for shipment Available now
sa11066 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16294
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124680 Nonsense 86 929 1 3
Genomic Location:
Chromosome 11 (position 18885808)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGACTTATATGACAAAGAGTTYGCTGTAAATTATGACACTACTTGCTA[T/A]GATGAAATAGAGGACAAATTGCAAATGGCAGTGGATGAAACAAWGGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124680 Nonsense 152 929 1 3
Genomic Location:
Chromosome 11 (position 18885610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAAAAGCGCTGATGATATCAAGCCAGCTGAGAGCAGAGAAGWTATTTA[T/A]AATGTACTTGAAGACACCAGTGCATGTTCTGAGAATGATACATCGACTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rpehebp8