ENG

Ensembl ID:
ENSDARG00000088795
Description:
endoglin [Source:HGNC Symbol;Acc:3349]
Human Orthologue:
ENG
Human Description:
endoglin [Source:HGNC Symbol;Acc:3349]
Mouse Orthologues:
Eng, Gm14378
Mouse Descriptions:
endoglin Gene [Source:MGI Symbol;Acc:MGI:95392]
predicted gene 14378 Gene [Source:MGI Symbol;Acc:MGI:3833469]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19936 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125008 Essential Splice Site 398 861 8 18
Genomic Location:
Chromosome 3 (position 6297289)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGAAGGCGGAGCTCTGACTGTTACCGTGGATATGCAGATGCTAAAGG[T/C]AGCAGACACACACACTGTATGATCCAGTGAACTAAAAATAAATGTTACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t56cpz4e