ENG

Ensembl ID:
ENSDARG00000088795
Description:
endoglin [Source:HGNC Symbol;Acc:3349]
Human Orthologue:
ENG
Human Description:
endoglin [Source:HGNC Symbol;Acc:3349]
Mouse Orthologues:
Eng, Gm14378
Mouse Descriptions:
endoglin Gene [Source:MGI Symbol;Acc:MGI:95392]
predicted gene 14378 Gene [Source:MGI Symbol;Acc:MGI:3833469]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25986 Nonsense Mutation detected in F1 DNA During 2016
sa19936 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38368 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125008 Nonsense 139 861 4 18
Genomic Location (Zv9):
Chromosome 3 (position 6305608)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5833894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGTTCATTGTGTGTTCCAGTTGTCTGTGAACTCCACGGCAGAGTCTT[C/A]GAGTCTGTCTGTCCGCGTAACGCAGGTCCCATCTCTGCCGCGGCGGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125008 Essential Splice Site 398 861 8 18
Genomic Location (Zv9):
Chromosome 3 (position 6297289)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5825575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGAAGGCGGAGCTCTGACTGTTACCGTGGATATGCAGATGCTAAAGG[T/C]AGCAGACACACACACTGTATGATCCAGTGAACTAAAAATAAATGTTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125008 Nonsense 413 861 9 18
Genomic Location (Zv9):
Chromosome 3 (position 6297040)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5825326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGCAGACACAGGTTTGGCCAGTGACGGCGGTGACCCTGCAAGATCCA[G/T]AGTGTAAAGCTGAATTTAACGGAAGTCATTTCCTGTTGGTTTCCCCCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link