ENSDARG00000088793

Ensembl ID:
ENSDARG00000088793
Human Orthologues:
MUC12, MUC4
Human Descriptions:
mucin 12, cell surface associated [Source:HGNC Symbol;Acc:7510]
mucin 4, cell surface associated [Source:HGNC Symbol;Acc:7514]
Mouse Orthologue:
Muc4
Mouse Description:
mucin 4 Gene [Source:MGI Symbol;Acc:MGI:2153525]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17215 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128699 Nonsense 490 932 1 9
Genomic Location:
Chromosome 11 (position 42341186)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACTGAAGGTCTGAGCACTTCAACCTTTACCCTGTCCAGTCCAGCTAAA[C/T]AAACAAGTCAACAAWCACAAACCACTATTTCAACCGCAAGCACAGGAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u5i33n24