LOC796144

Ensembl ID:
ENSDARG00000088789
Human Orthologue:
MAST1
Human Description:
microtubule associated serine/threonine kinase 1 [Source:HGNC Symbol;Acc:19034]
Mouse Orthologue:
Mast1
Mouse Description:
microtubule associated serine/threonine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1861901]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19944 Nonsense Mutation detected in F1 DNA During 2014
sa15819 Nonsense Available for shipment Available now
sa11571 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123809 Nonsense 413 1649 14 29
Genomic Location:
Chromosome 3 (position 7321497)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGCAGAACCTGATTCTGAGGAACCAGATCCAGCAGGCGTTTGTGGAG[C/T]GAGACATCCTGACCTTTGCTGAGAACCCGTTCGTGGTCAGCATGTTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123809 Nonsense 866 1649 23 29
Genomic Location:
Chromosome 3 (position 7308032)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCRCATGCCGGAGCCCTTCAGTGCACGAGTAGGAAGTGACCTCGTCT[T/A]ACGAAGAGCACGACATCATCAGATACCGAGCKACAGTGAGAAACGAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123809 Essential Splice Site 1069 1649 26 29
Genomic Location:
Chromosome 3 (position 7306263)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATGGCCAGACGCAACAAGAAATCAGCAGCAAAAGATGGACAAGAGAG[G/A]TCAGAAACTGGGAATGCCTTTACATCATGGGTCAAACTCARCTCCTGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bliy14pp