FNDC3B (2 of 3)

Ensembl ID:
ENSDARG00000088779
Description:
fibronectin type III domain containing 3B [Source:HGNC Symbol;Acc:24670]
Human Orthologue:
FNDC3B
Human Description:
fibronectin type III domain containing 3B [Source:HGNC Symbol;Acc:24670]
Mouse Orthologue:
Fndc3b
Mouse Description:
fibronectin type III domain containing 3B Gene [Source:MGI Symbol;Acc:MGI:1919257]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39512 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130256 Essential Splice Site 151 170 4 4
Genomic Location (Zv9):
Chromosome Zv9_NA312 (position 567)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150010.1 567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTAAAGGTAATTCACTTCTATAAACAGACTGTCTGTGTTTGTTTCA[G/A]TGGCGAGGAGCTCCAGCACACTCTCACTGACCTCAGACCAGCCACAGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Corneal structure: Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link