MAPKBP1

Ensembl ID:
ENSDARG00000088774
Description:
mitogen-activated protein kinase binding protein 1 [Source:HGNC Symbol;Acc:29536]
Human Orthologue:
MAPKBP1
Human Description:
mitogen-activated protein kinase binding protein 1 [Source:HGNC Symbol;Acc:29536]
Mouse Orthologue:
Mapkbp1
Mouse Description:
mitogen-activated protein kinase binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1347004]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23006 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11673 Essential Splice Site Available for shipment Available now
sa36331 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128909 Essential Splice Site 273 961 7 23
Genomic Location:
Chromosome 17 (position 9955516)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGAGTTCAACGACAAAAGAATGCTGGACAAGTGGGTGGAGCTCAGGG[T/C]GAGTCACGAGGATGCTGATTGGTGGTTGTGTAAATAAACAACTTTGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128909 Essential Splice Site 571 961 14 23
Genomic Location:
Chromosome 17 (position 9928325)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTWACAACWAATACTAGRAATGTTAATGTGTGACGTGTGCTTCTTTTCCA[G/A]CTAATGAAGGAAAAGTCCGAATGATCAGTTGTGGTGCTGATAAGAGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128909 Nonsense 577 961 14 23
Genomic Location:
Chromosome 17 (position 9928307)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTTAATGTGTGACGTGTGCTTCTTTTCCAGCTAATGAAGGAAAAGTC[C/T]GAATGATCAGTTGTGGTGCTGATAAGAGCATCTACTTCCGCACGGCACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link