MAPKBP1

Ensembl ID:
ENSDARG00000088774
Description:
mitogen-activated protein kinase binding protein 1 [Source:HGNC Symbol;Acc:29536]
Human Orthologue:
MAPKBP1
Human Description:
mitogen-activated protein kinase binding protein 1 [Source:HGNC Symbol;Acc:29536]
Mouse Orthologue:
Mapkbp1
Mouse Description:
mitogen-activated protein kinase binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1347004]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23006 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11673 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128909 Essential Splice Site 273 961 7 23
Genomic Location:
Chromosome 17 (position 9955516)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGAGTTCAACGACAAAAGAATGCTGGACAAGTGGGTGGAGCTCAGGG[T/C]GAGTCACGAGGATGCTGATTGGTGGTTGTGTAAATAAACAACTTTGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128909 Essential Splice Site 571 961 14 23
Genomic Location:
Chromosome 17 (position 9928325)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTWACAACWAATACTAGRAATGTTAATGTGTGACGTGTGCTTCTTTTCCA[G/A]CTAATGAAGGAAAAGTCCGAATGATCAGTTGTGGTGCTGATAAGAGCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c8hniqkd