si:ch211-224l10.4

Ensembl ID:
ENSDARG00000088762
ZFIN ID:
ZDB-GENE-090312-125
Human Orthologue:
MFSD2A
Human Description:
major facilitator superfamily domain containing 2A [Source:HGNC Symbol;Acc:25897]
Mouse Orthologue:
Mfsd2a
Mouse Description:
major facilitator superfamily domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:1923824]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37653 Nonsense Mutation detected in F1 DNA During 2017
sa11165 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125449 Nonsense 48 508 2 14
ENSDART00000132573 Nonsense 48 469 2 13

The following transcripts of ENSDARG00000088762 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 16907588)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16810527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTATGAAATGACTATAACCGTCAAGGTCTTTTTCATGCAGATCTTTT[T/A]ACTGGATGTTGTGAAGGTGAGTACAAAAGATTTGGTTTTGCAGCTGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11165
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125449 Essential Splice Site 54 508 3 14
ENSDART00000132573 Essential Splice Site 54 469 3 13

The following transcripts of ENSDARG00000088762 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 16904728)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16807667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGAATTTTTACATTTTCTTTTGTGCATGTTTTATATATAAATATATA[G/A]ATGGAAGCCTTTTATGCATCCCTCATTCTCTTCCTCGGTCGAGCTTGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link