si:ch211-57h10.1

Ensembl ID:
ENSDARG00000088753
ZFIN ID:
ZDB-GENE-060526-173
Description:
Uncharacterized protein C4orf22 homolog [Source:UniProtKB/Swiss-Prot;Acc:A2AVJ0]
Human Orthologue:
C4orf22
Human Description:
chromosome 4 open reading frame 22 [Source:HGNC Symbol;Acc:28554]
Mouse Orthologue:
1700007G11Rik
Mouse Description:
RIKEN cDNA 1700007G11 gene Gene [Source:MGI Symbol;Acc:MGI:1916571]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44613 Nonsense Mutation detected in F1 DNA During 2017
sa20494 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097872 Nonsense 77 239 2 6
ENSDART00000131245 Nonsense 77 257 2 6
Genomic Location (Zv9):
Chromosome 5 (position 41171609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACAAGAAAAGCAGCTGCCGAGGCCTCCAGGCTTGCTTCAGGAAGCCAA[C/T]AGAAGTAAGGTTTTTGTGTAGTGACCATGAAAAGGGGACAGATTTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097872 Essential Splice Site 156 239 5 6
ENSDART00000131245 Essential Splice Site 156 258 5 6
Genomic Location (Zv9):
Chromosome 5 (position 41266566)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39060458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAATCTCTAAACAATTAGAAATGTATTAACCTCAACCTTTTCTTTCA[G/T]CTTCTACAACTGGAGGACGCAGAAGTCCAAACACAATAACAGCTCAAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link