IMPG2 (3 of 4)

Ensembl ID:
ENSDARG00000088751
Description:
interphotoreceptor matrix proteoglycan 2 [Source:HGNC Symbol;Acc:18362]
Human Orthologue:
IMPG2
Human Description:
interphotoreceptor matrix proteoglycan 2 [Source:HGNC Symbol;Acc:18362]
Mouse Orthologue:
Impg2
Mouse Description:
interphotoreceptor matrix proteoglycan 2 Gene [Source:MGI Symbol;Acc:MGI:3044955]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21505 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111499 Essential Splice Site 27 150 2 3
Genomic Location:
Chromosome 9 (position 31230712)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTGTGCCAGGAGGAAGATGGGTACATTTATGTGTATATATCTGTTTC[A/G]GAAGAAGATGACCAGAACACTTTGGTTGGAAATGCAAATGAGCACTCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sezqj2jf