LOC100001306

Ensembl ID:
ENSDARG00000088736

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22157 Nonsense Mutation detected in F1 DNA During 2014
sa19041 Nonsense Available for shipment Available now
sa16449 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126325 Nonsense 203 437 9 16
Genomic Location:
Chromosome 12 (position 37236689)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTTTCTGAAGGTACCTAGATGGACGTGTGTTTGTGTTGGATCTGCTT[C/T]AGGGTAGTCAAGCTCAAGTGGATATGTTCGCGGAGCCTGGTGACATCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126325 Nonsense 435 437 16 16
ENSDART00000126325 Nonsense 435 437 16 16
Genomic Location:
Chromosome 12 (position 37231940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTTGTACATTTTTGTGCCTACAGCTGCTGGGTTTAAGCATACAGAAT[G/A]GTTTGTCTGAAAATCTCAAAACCTTGAGTGAACTGGACATCTTCAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126325 Nonsense 435 437 16 16
ENSDART00000126325 Nonsense 435 437 16 16
Genomic Location:
Chromosome 12 (position 37231940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTTGTACATTTTTGTGCCYACAGCTGCTGGGTTTAAGCATACAGAAT[G/A]GTTTGTCTGAAAATCTCAAAACCTTGAGTGAACTGGACATCTTCAAATST
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/suhov3qh