ENSDARG00000088733

Ensembl ID:
ENSDARG00000088733
Human Orthologues:
AL049692.1, EGR1, EGR2, EGR3, EGR4, WT1, WT1, WT1
Human Descriptions:
early growth response 1 [Source:HGNC Symbol;Acc:3238]
early growth response 2 [Source:HGNC Symbol;Acc:3239]
early growth response 3 [Source:HGNC Symbol;Acc:3240]
early growth response 4 [Source:HGNC Symbol;Acc:3241]
Wilms tumor 1 [Source:HGNC Symbol;Acc:12796]
Wilms tumor 1 [Source:HGNC Symbol;Acc:12796]
Wilms tumor 1 [Source:HGNC Symbol;Acc:12796]
Wilms tumor 1 [Source:UniProtKB/TrEMBL;Acc:A0FJ58]
Mouse Orthologues:
Egr1, Egr2, Egr3, Egr4, Wt1
Mouse Descriptions:
early growth response 1 Gene [Source:MGI Symbol;Acc:MGI:95295]
early growth response 2 Gene [Source:MGI Symbol;Acc:MGI:95296]
early growth response 3 Gene [Source:MGI Symbol;Acc:MGI:1306780]
early growth response 4 Gene [Source:MGI Symbol;Acc:MGI:99252]
Wilms tumor 1 homolog Gene [Source:MGI Symbol;Acc:MGI:98968]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12755 Essential Splice Site Available for shipment Available now
sa40281 Nonsense Mutation detected in F1 DNA During 2016
sa20262 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106490 Essential Splice Site 15 289 1 2
Genomic Location:
Chromosome 4 (position 18992078)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGATGGAAGTGAAAGAGGAAAGTGAAGAACWGAGTGCAGATGAGAAAA[G/A]TCAGTATCAGGCAACCTAATTCAGGGTTTCTGTGGGTACTAAAAANNCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106490 Nonsense 202 289 2 2
Genomic Location:
Chromosome 4 (position 18994899)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCACCAGAAGTTACATAATGGTGTGAAGGAGCATGTTTGCTCGGTGTG[C/A]GGCAGCTGCTTTACTAAAGTGTACTATCTGCAACAGCACCAAAGGATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106490 Nonsense 214 289 2 2
Genomic Location:
Chromosome 4 (position 18994933)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTGCTCGGTGTGCGGCAGCTGCTTTACTAAAGTGTACTATCTGCAA[C/T]AGCACCAAAGGATCCATACTGGAGAAAAACCGTACAAGTGTACACAATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Atopic dermatitis: Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population. (View Study)
  • Ewing sarcoma: Common variants near TARDBP and EGR2 are associated with susceptibility to Ewing sarcoma. (View Study)
  • Temperament: A genome-wide meta-analysis of association studies of Cloninger's Temperament Scales. (View Study)
  • Tuberculosis: Common variants at 11p13 are associated with susceptibility to tuberculosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link