LOC100333485

Ensembl ID:
ENSDARG00000088727
Human Orthologues:
CD207, CD209, CLEC4F, CLEC4M, FCER2
Human Descriptions:
C-type lectin domain family 4, member F [Source:HGNC Symbol;Acc:25357]
C-type lectin domain family 4, member M [Source:HGNC Symbol;Acc:13523]
CD207 molecule, langerin [Source:HGNC Symbol;Acc:17935]
CD209 molecule [Source:HGNC Symbol;Acc:1641]
Fc fragment of IgE, low affinity II, receptor for (CD23) [Source:HGNC Symbol;Acc:3612]
Mouse Orthologues:
Cd207, Cd209a, Cd209b, Cd209c, Cd209d, Cd209e, Cd209f, Cd209g, Clec4f, Fcer2a
Mouse Descriptions:
C-type lectin domain family 4, member f Gene [Source:MGI Symbol;Acc:MGI:1859834]
CD207 antigen Gene [Source:MGI Symbol;Acc:MGI:2180021]
CD209a antigen Gene [Source:MGI Symbol;Acc:MGI:2157942]
CD209b antigen Gene [Source:MGI Symbol;Acc:MGI:1916415]
CD209c antigen Gene [Source:MGI Symbol;Acc:MGI:2157945]
CD209d antigen Gene [Source:MGI Symbol;Acc:MGI:2157947]
CD209e antigen Gene [Source:MGI Symbol;Acc:MGI:2157948]
CD209f antigen Gene [Source:MGI Symbol;Acc:MGI:1916392]
CD209g antigen Gene [Source:MGI Symbol;Acc:MGI:1917442]
Fc receptor, IgE, low affinity II, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:95497]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12930 Nonsense Available for shipment Available now
sa16158 Nonsense Available for shipment Available now
sa21732 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125317 Nonsense 139 327 3 6
Genomic Location:
Chromosome 10 (position 23780589)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAGACARAGAMAAGCTACTAACCGACATCATCAATCTCACARAAATC[A/G]AAGACAAGGTTCTAATCAACATCACCAACCTCGAAGAAGACAGGGATRAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125317 Nonsense 139 327 3 6
Genomic Location:
Chromosome 10 (position 23780589)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAGACARAGAMAAGCTACTAACCGACATCATCAATCTCACARAAATC[A/T]AAGACAAGGTTCTAATCAACATCACCAACCTCGAAGAAGACAGGGATRAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125317 Nonsense 315 327 6 6
Genomic Location:
Chromosome 10 (position 23781476)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCACCCTGAGTTAATAGGATGGCTTGATGTTGCATGTGATGGTGCTTA[T/A]CAATGGATCTGTGAGAAAAATATTTTACCAGTTACCAGTTAAGCAACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cpq786mi