ENSDARG00000088720

Ensembl ID:
ENSDARG00000088720
Human Orthologues:
THAP6, THAP7, THAP9
Human Descriptions:
THAP domain containing 6 [Source:HGNC Symbol;Acc:23189]
THAP domain containing 7 [Source:HGNC Symbol;Acc:23190]
THAP domain containing 9 [Source:HGNC Symbol;Acc:23192]
Mouse Orthologues:
Thap6, Thap7
Mouse Descriptions:
THAP domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1922436]
THAP domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:1916259]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24815 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129717 Nonsense 88 723 1 2
Genomic Location:
Chromosome Zv9_NA776 (position 5793)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTGATGAAGTGCCAAAGCACATCTTGTTGAAAATACAGCAGGGGAAT[A/T]AAACAGCAAAGTACTCAGAGGAGTTGAAGCAGTTTGCCACAACCTTGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/do479lpj