LOC561279

Ensembl ID:
ENSDARG00000088699
Human Orthologue:
PDZD8
Human Description:
PDZ domain containing 8 [Source:HGNC Symbol;Acc:26974]
Mouse Orthologue:
Pdzd8
Mouse Description:
PDZ domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:2677270]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36406 Nonsense Mutation detected in F1 DNA During 2017
sa36405 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122108 Nonsense 223 1180 1 5
Genomic Location (Zv9):
Chromosome 17 (position 23723843)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23873992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTTCATCTGGCCATCGACGTCGATCTGGTTTTCGGTAAATCGGCTTA[T/A]CTGTTCGTCAAGATGACCCGGGTCGCAGGCCGCCTGAAGCTGCAGTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122108 Nonsense 1064 1180 5 5
Genomic Location (Zv9):
Chromosome 17 (position 23652782)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23802931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCAACTGACGAGCGTTCACAAAAATTAGAGTTAATGCTGGACAAGTTG[C/T]AGCAGGAGATTGACCAGGAGCTGGAGCATAACAACTCGCTGAGTACTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link