dcst2

Ensembl ID:
ENSDARG00000088693
ZFIN ID:
ZDB-GENE-070809-6
Human Orthologue:
DCST2
Human Description:
DC-STAMP domain containing 2 [Source:HGNC Symbol;Acc:26562]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36162 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122082 Essential Splice Site 483 652 9 15
ENSDART00000122082 Essential Splice Site 483 652 9 15
Genomic Location (Zv9):
Chromosome 16 (position 30977890)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28815028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTCGTGAAGCCTTCGGAGCCTGATTACATGAGATACCTGCTCATTGG[T/G]AAAACTACAATTCGAAGTATTATGTACTTATATTGCACATGCGGTCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link