C11orf82

Ensembl ID:
ENSDARG00000088690
Description:
chromosome 11 open reading frame 82 [Source:HGNC Symbol;Acc:26351]
Human Orthologue:
C11orf82
Human Description:
chromosome 11 open reading frame 82 [Source:HGNC Symbol;Acc:26351]
Mouse Orthologue:
4632434I11Rik
Mouse Description:
RIKEN cDNA 4632434I11 gene Gene [Source:MGI Symbol;Acc:MGI:1921291]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9523 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122869 Nonsense 176 663 4 4
Genomic Location:
Chromosome 21 (position 21991091)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGATTATCTTAAAACCCTCCAGCAAGCGAATTCAAATTCWTGCCATTA[T/A]GAATCTGCAAGCAATGTTTGTTTTTCACAACAGAAGAATTCACAGACTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cyqxc2m9