NLRP6 (81 of 83)

Ensembl ID:
ENSDARG00000088689
Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22735 Nonsense Available for shipment Available now
sa42637 Nonsense Mutation detected in F1 DNA During 2017
sa36009 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130078 Nonsense 205 988 2 8
Genomic Location (Zv9):
Chromosome 16 (position 186798)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 162414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCATCAAGGGGAATCTGCTTCCCTCAGCTCTCCTCTGGATTACCACA[C/T]GACCATCCACAGCCGGCCGGATCCCTCCTGAGTGTGTCCATCGGGTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42637
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130078 Nonsense 234 988 2 8
Genomic Location (Zv9):
Chromosome 16 (position 186887)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 162503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGGGTCACAGAGATCCGCGGGTTCAGTGATGATCAAAAAGACTCTTA[C/A]TTCAGGAAGAAAATCAGCGATCAGACACTAGCAGATGAAATCATCAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130078 Nonsense 782 988 6 8
Genomic Location (Zv9):
Chromosome 16 (position 190309)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 165925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGATTGCATGAGTGAACTGGATTTGACCTACAACCATCCTGGAGACT[C/A]GGGAGTGAAGCTGCTCACTGCTAAAAAAGAGGATCCCAACTGTAAACTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link