si:dkey-192d15.3

Ensembl ID:
ENSDARG00000088682
ZFIN ID:
ZDB-GENE-040724-245
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RIY1]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20847 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011852 Nonsense 75 239 1 2
ENSDART00000138164 Nonsense 75 355 1 3
Genomic Location (Zv9):
Chromosome 7 (position 3803257)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 3493671
KASP Assay ID:
2259-8360.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACGTGTCTGGATTGGTCTTCAGAGGACGAGTGTTTATAAATGGCATT[G/A]GTCTTCAGGTGATCCTGCGCTCTTTCTGAACTGGGCATCTGGACAACCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link